View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_low_52 (Length: 238)
Name: NF1490_low_52
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 15 - 213
Target Start/End: Complemental strand, 38701421 - 38701232
Alignment:
| Q |
15 |
cagagaagtttgaatgtactgcagcgaatctaacacccccttcacaaaacaaaaccattgaggatcatgttttgtagggccccgtttgacagtttaggac |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38701421 |
cagagaagtttgaatgtactgcagcgaatctaacatccccttcacaaaacaaaaccattgaggatcatgttttgtagggccc---------gtttaggac |
38701331 |
T |
 |
| Q |
115 |
tttgtatgaaaagtagtttggttgtagtcttggcttaagaattgcactcttagatccatccagtttgtaaagggtaaatatttagaggtttatttatag |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38701330 |
tttgtatgaaaagtagtttggttgtagtcttagcttaagaattgcactcttagatccatccagtttgtaaagggtaaatatttagaggtttatttatag |
38701232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 161 - 217
Target Start/End: Complemental strand, 10239298 - 10239242
Alignment:
| Q |
161 |
ctcttagatccatccagtttgtaaagggtaaatatttagaggtttatttatagactt |
217 |
Q |
| |
|
||||||||||||||| |||| | |||||||||||| |||| |||||||| |||||| |
|
|
| T |
10239298 |
ctcttagatccatccgatttgcacagggtaaatattgagagctttatttagagactt |
10239242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University