View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1490_low_64 (Length: 204)
Name: NF1490_low_64
Description: NF1490
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1490_low_64 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
| [»] scaffold0126 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 36798794 - 36798591
Alignment:
| Q |
1 |
gaatagagaagcagctagaaaaagcaggcttaggaaaaaggtaaatggtttcacacgaagatcattaaattccatatatgtgttgtatttgttacatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36798794 |
gaatagagaagcagctagaaaaagcaggcttagaaaaaaggtaaatggtttcacatgaagatcattaaattccatatatgtgttgtatttgttacatttt |
36798695 |
T |
 |
| Q |
101 |
ttgtcaatagaatctctaaattatgaactattatatgtataattttatttgtattctttttcaggcatatattcagcagcttgaatcaagtagaattaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36798694 |
ttgtcaatagaatctctaaattatgaactattatatgtataattttatttgtactctttttcaggcatatattcagcagcttgaatcaagtagaattaaa |
36798595 |
T |
 |
| Q |
201 |
ctta |
204 |
Q |
| |
|
|||| |
|
|
| T |
36798594 |
ctta |
36798591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 25927 - 25886
Alignment:
| Q |
1 |
gaatagagaagcagctagaaaaagcaggcttaggaaaaaggt |
42 |
Q |
| |
|
||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
25927 |
gaatagagaggcagcaagaaaaagcaggcttaggaaaaaggt |
25886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University