View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14912_high_29 (Length: 254)
Name: NF14912_high_29
Description: NF14912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14912_high_29 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 27 - 235
Target Start/End: Original strand, 31036835 - 31037043
Alignment:
| Q |
27 |
actcatcaaatgcgctggatggcaaaggcgttggcgtttggtctaatggagggccgatggccagtgaatggaaaagatcgtatacagagaaggttgcatc |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
31036835 |
actcatcaaatgcgctggatggcaaaggcgttggcgtatggtctaatggagggccgagggccagtgaatggaaaaaatcgtatacagagaaggttgtatc |
31036934 |
T |
|
| Q |
127 |
gtgtaaaagtatatagagaagctgatacaaagttggattatttgacattaaggtttggtcaagtttcttaaagcttgtgtggtaccttagttgaaaacat |
226 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31036935 |
gtgtaaaagtatatagagaagctgagacaaagttggattatttgacattaaggtttggtcaagtttcttaaagcttgtgtggtaccttagttgaaaacat |
31037034 |
T |
|
| Q |
227 |
agtatatta |
235 |
Q |
| |
|
||||||||| |
|
|
| T |
31037035 |
agtatatta |
31037043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University