View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14912_low_17 (Length: 344)
Name: NF14912_low_17
Description: NF14912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14912_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 180 - 318
Target Start/End: Original strand, 7278608 - 7278749
Alignment:
| Q |
180 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaattatattct---ttcacacatttaccctcgctaccattctc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| ||||||||||||||||||||||||| ||| |
|
|
| T |
7278608 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaatgatcttcttctttcacacatttaccctcgctaccatcctc |
7278707 |
T |
|
| Q |
277 |
attcatcagaggtcccattttttcacctccctcattcttctc |
318 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7278708 |
attcatcaaaggtcccattttttcacctccctcattcttctc |
7278749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 180 - 318
Target Start/End: Complemental strand, 7375231 - 7375090
Alignment:
| Q |
180 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaattatattctt---tcacacatttaccctcgctaccattctc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||| ||| |
|
|
| T |
7375231 |
ataaagcttccactttgtcaccttcctcatcttcaccacccccctccttcatcaaaaaatgatcttcttctttcacacatttaccctcgctaccatcctc |
7375132 |
T |
|
| Q |
277 |
attcatcagaggtcccattttttcacctccctcattcttctc |
318 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7375131 |
attcatcaaaggtcccattttttcacctccctcattcttctc |
7375090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 18 - 121
Target Start/End: Original strand, 7278446 - 7278549
Alignment:
| Q |
18 |
cttcctcccccaaacttgttcccacactctcttccttctcttctacctccatcttcttcacatcctcattgctctcctcattccccaaagcttcaaattt |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7278446 |
cttcctccaccaaacttgttcccacactctcttccttctcttctacctccatcttcttcacatcctcattgttctcctcattccccaaagcttcaaattt |
7278545 |
T |
|
| Q |
118 |
ttca |
121 |
Q |
| |
|
|||| |
|
|
| T |
7278546 |
ttca |
7278549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 18 - 121
Target Start/End: Complemental strand, 7375393 - 7375290
Alignment:
| Q |
18 |
cttcctcccccaaacttgttcccacactctcttccttctcttctacctccatcttcttcacatcctcattgctctcctcattccccaaagcttcaaattt |
117 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7375393 |
cttcctccaccaaacttgttcccacactctcttccttctcttctacctccatcttcttcacatcctcattgttctcctcattccccaaagcttcaaattt |
7375294 |
T |
|
| Q |
118 |
ttca |
121 |
Q |
| |
|
|||| |
|
|
| T |
7375293 |
ttca |
7375290 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University