View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14912_low_21 (Length: 323)
Name: NF14912_low_21
Description: NF14912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14912_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 10 - 308
Target Start/End: Complemental strand, 46933629 - 46933341
Alignment:
| Q |
10 |
ataatacttagcttatgcaatttcaatttagggcgtgcggcgaaggctcaattacggaacaagttcaacaattcatcttagaccattgtctttccacacc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46933629 |
ataatacttagcttatgcaatttcaatttagggcgtgcggcgaaggctcaattacggaacaagttcaacaattcatcttagaccattgtctttccacacc |
46933530 |
T |
 |
| Q |
110 |
tgtaaatttcaattatcttctctggctctgctctgctctgctctgtgtttttcattttcccattaatctttcaattatttgctactcttaatgcagagtg |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46933529 |
tgtaaatttcaattatcttctctggctctgctctg----------tgtttttcattttcccataaatctttcaattatttgctactcttaatgcagagtg |
46933440 |
T |
 |
| Q |
210 |
atttttatgcaccttacttgaagaattttcttaagaagcttatcactcaagttgagtccgatcatggctccgtcttggacaaattttaccaactctatg |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46933439 |
atttttatgcaccttacttgaagaattttcttaagaagcttatcactcaagttgagtccgatcatggctccgtcttggacaaattttaccaactctatg |
46933341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University