View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14912_low_22 (Length: 323)
Name: NF14912_low_22
Description: NF14912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14912_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 258; Significance: 1e-143; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 2356395 - 2356089
Alignment:
| Q |
1 |
ccaattccttagaagnnnnnnncatagctttcacatggccgtcaaaatcaaaccgttctaaacaaggaatagcatctcccaacgagaattgccccatcaa |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
2356395 |
ccaattccttagaagtttttttcatagctttcacatggccaccaaaatcaaaccgttctaaacaaggaatagcatctcccaccgtgaattgccccatcaa |
2356296 |
T |
 |
| Q |
101 |
acgcaagatttcctccacggctttgatacacttttgcgcttctttctcatcgagctcattcatagcaccaaaataccgcttcccaacaatcatcggaagt |
200 |
Q |
| |
|
||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2356295 |
acgcaagatttcctctacagctttgatacacttttgcgcttctttctcatcgagctcattcatagcaccaaaatatcgcttcccaacaatcatcggaagt |
2356196 |
T |
 |
| Q |
201 |
acaatgttgaaattcaactcaataaaccattgcctcaactcgactaacacatagttggactcgttattactcttccaaacattgaagagctctttaatcg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2356195 |
acaatgttgaaattcaactcaataaaccattgcctcaactcgactaacacatagttggactcgttattactcttccaaacattgaagagctctttaatcg |
2356096 |
T |
 |
| Q |
301 |
aagtttg |
307 |
Q |
| |
|
||||||| |
|
|
| T |
2356095 |
aagtttg |
2356089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University