View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14912_low_23 (Length: 303)
Name: NF14912_low_23
Description: NF14912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14912_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 36 - 280
Target Start/End: Original strand, 40688645 - 40688886
Alignment:
| Q |
36 |
ggcaaatcatgaatatatgagaatgtttccaagtggatttatgtgattaatgtaagctgctgattgtcaacgttcagttgctttaaaacggaagcaaaaa |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||| | |
|
|
| T |
40688645 |
ggcaaatcatgaatatatgagaatgtttccaagtggatttatgtgattaatgtaagctgctgattgtcaacgctcagttgctttgaaacgaaagcaaaga |
40688744 |
T |
|
| Q |
136 |
gttgtaagactaagatgtactcatgtcaatgtcaagtaactctacaaaaaatggtttcttctctttcgtgtttgcacacgcat----gcacaaacaaata |
231 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40688745 |
gttgtaaga------tgtactaatgtcaatgtcaagtaactctacaaaaaatggtt-cttctctttcgtgtttgcacacgcatgcatgcacaaacaaata |
40688837 |
T |
|
| Q |
232 |
ataaatctcgtcattattttccagcatatgatgataatgaacatatcac |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40688838 |
ataaatctcgtcattattttccagcatatgatgataatgaacatatcac |
40688886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University