View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14912_low_26 (Length: 296)
Name: NF14912_low_26
Description: NF14912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14912_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 48 - 282
Target Start/End: Complemental strand, 42897962 - 42897734
Alignment:
| Q |
48 |
caatttagataaataaaacaagaatgggcgcatgttttggattcacgaggaatttggtgaaattattgtaccagtcaccgtgagtttgcagaagctacgc |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42897962 |
caatttagataaataaaacaagaatgggcgcatgttt-ggattcactaggaatttggtgaaattattgtaccagtcaccgtgagtttgcagaagatacgc |
42897864 |
T |
|
| Q |
148 |
tcttgagcttcgacaaaatcacggtggtaactttgtcaaatctaccgtgattccaaacaagcataacatgttaaacacacgtgtagttctaaattgccat |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42897863 |
tcttgagcttcgacaaaatcacggtggtaac---gtcaaat--accgtgattccaaacaagcataacatgttaaacacacgtgtagttctaaattgccat |
42897769 |
T |
|
| Q |
248 |
ttgcatctgcaattgcagctgaaatataccggttt |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42897768 |
ttgcatctgcaattgcagctgaaatataccggttt |
42897734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University