View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14912_low_35 (Length: 252)
Name: NF14912_low_35
Description: NF14912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14912_low_35 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 252
Target Start/End: Complemental strand, 3420375 - 3420136
Alignment:
| Q |
18 |
agatcaaacatggcgtcgcctttgtcagaatcaaatgattgatagtagtatcctctacacacaactgcaacaattaatatttctggcttgtgaattcaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3420375 |
agatcaaacatggcgtcgcctttgtcagaatcaaatgattgatagtagtatcctctacacacaactgcaacaattaatatttctggcttgtgaattcaaa |
3420276 |
T |
|
| Q |
118 |
gtggactgcaaagtctcttgtatgggttttaggttgtcgtatgtccaaattttggttcgaattcacggccttagtcgagttaaaataaataattgtgttc |
217 |
Q |
| |
|
||||||||||||||||||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3420275 |
gtggactgcaaagtctcttttaagggttttaagttgtcgtatgtccaaattttggttcgaattcacggccttagtcaagttaaaataaataattgtgttc |
3420176 |
T |
|
| Q |
218 |
g-----tgtcgtttcatctgaacgttctcacgttacttat |
252 |
Q |
| |
|
| | || ||||||||||||||||||| ||||||||| |
|
|
| T |
3420175 |
gtatcatttcatttcatctgaacgttctcatgttacttat |
3420136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University