View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14912_low_46 (Length: 214)
Name: NF14912_low_46
Description: NF14912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14912_low_46 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 6e-36; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 106 - 186
Target Start/End: Complemental strand, 21134103 - 21134023
Alignment:
| Q |
106 |
ctaaatcggtagatttggtacactcttaagtatcttaaagttgagttgggtattggtatcctgtaagtaaaattcattcaa |
186 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21134103 |
ctaaatcggtagatttgatacactcttaagtatcttaaagttgagttgggtattggtatcctgtaagtaaaattcattcaa |
21134023 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 23 - 109
Target Start/End: Complemental strand, 21135729 - 21135642
Alignment:
| Q |
23 |
gcattaatgatattgtcattttatctatctacannnnnnnn-ataacactatatctatgtctaagtatatcaactccctctaggctaa |
109 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||| |||| ||||||||||||||||||||||| | ||| ||||||||||| |
|
|
| T |
21135729 |
gcatcaatgatattgtcattttatttatctacatttttttctataaaactatatctatgtctaagtatatgatctctctctaggctaa |
21135642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University