View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14912_low_7 (Length: 540)
Name: NF14912_low_7
Description: NF14912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14912_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 308 - 530
Target Start/End: Original strand, 28767254 - 28767476
Alignment:
| Q |
308 |
actactatgccacttgcactttatgttgttattattacccccataattattaatacactatagttgttgttagttgggctactacccccaattacaatcc |
407 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28767254 |
actactatgccacttgcactttatgttgttattattacccccataattattaatacactataattgttgttagttgggctactacccccaattacaatcc |
28767353 |
T |
 |
| Q |
408 |
catgtcaccctatataatccaatcataagataaaatcatttgccaaattcattaactattcaactttttgaaccctatctctcttctcttcattcttcaa |
507 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28767354 |
catgtcaccctatataatccaatcataagataaaatcatttgccaaattcattaactattcaactttttgaaccctatctctcttctcttcattcttcaa |
28767453 |
T |
 |
| Q |
508 |
tgactgcttctgtttcacctatg |
530 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
28767454 |
tgactgcttctgtttcacctatg |
28767476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 216 - 289
Target Start/End: Original strand, 28767192 - 28767258
Alignment:
| Q |
216 |
aaaccaaaccaaccatgttattatttaatattacttacttgcacgtgacgtgtttggttgaggagttcaactac |
289 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
28767192 |
aaaccaaaccaaccatgttattatt-------acttacttacacgtgacgtgtttggttaaggagttcaactac |
28767258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 27678598 - 27678558
Alignment:
| Q |
167 |
cggttcgaccggttggtccggtccggttttcaaaactatgc |
207 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
27678598 |
cggttcaaccggccggtccggtccggttttcaaaactatgc |
27678558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 40484728 - 40484688
Alignment:
| Q |
167 |
cggttcgaccggttggtccggtccggttttcaaaactatgc |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
40484728 |
cggttcgaccggccggtccggtccggtttttaaaactatgc |
40484688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000005; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 159 - 206
Target Start/End: Complemental strand, 24067365 - 24067318
Alignment:
| Q |
159 |
ccggttcacggttcgaccggttggtccggtccggttttcaaaactatg |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
24067365 |
ccggttcacggttcgaccggccggtccggtccgattttcaaaactatg |
24067318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 167 - 206
Target Start/End: Complemental strand, 22350510 - 22350471
Alignment:
| Q |
167 |
cggttcgaccggttggtccggtccggttttcaaaactatg |
206 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22350510 |
cggttcgaccggccggtccggtccggttttcaaaactatg |
22350471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 167 - 207
Target Start/End: Original strand, 11466200 - 11466240
Alignment:
| Q |
167 |
cggttcgaccggttggtccggtccggttttcaaaactatgc |
207 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
11466200 |
cggttcaaccggccggtccggtccggttttcaaaactatgc |
11466240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 168 - 207
Target Start/End: Original strand, 18541523 - 18541562
Alignment:
| Q |
168 |
ggttcgaccggttggtccggtccggttttcaaaactatgc |
207 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18541523 |
ggttcgaccggccggtccggtccggttttcaaaactatgc |
18541562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 37314266 - 37314226
Alignment:
| Q |
167 |
cggttcgaccggttggtccggtccggttttcaaaactatgc |
207 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
37314266 |
cggttcaaccggccggtccggtccggttttcaaaactatgc |
37314226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.00000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 159 - 206
Target Start/End: Original strand, 9294548 - 9294595
Alignment:
| Q |
159 |
ccggttcacggttcgaccggttggtccggtccggttttcaaaactatg |
206 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
9294548 |
ccggttcacggtcggaccggccggtccggtccggttttcaaaactatg |
9294595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 167 - 210
Target Start/End: Original strand, 28235728 - 28235771
Alignment:
| Q |
167 |
cggttcgaccggttggtccggtccggttttcaaaactatgcatg |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
28235728 |
cggttcgaccggccggtccggtccggtttttaaaactatgcatg |
28235771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 25231957 - 25231891
Alignment:
| Q |
140 |
gctcgaaccgtctataccaccggttcacggttcgaccggttggtccggtccggttttcaaaactatg |
206 |
Q |
| |
|
|||||||||| || |||||||||||||||| | |||||| |||||| |||| ||||||||||||| |
|
|
| T |
25231957 |
gctcgaaccggatacaccaccggttcacggtccaaccggtcggtccgagccgggtttcaaaactatg |
25231891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 167 - 207
Target Start/End: Complemental strand, 2848533 - 2848493
Alignment:
| Q |
167 |
cggttcgaccggttggtccggtccggttttcaaaactatgc |
207 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
2848533 |
cggttcgaccggccggtccggtccggtttttaaaactatgc |
2848493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University