View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14913_high_9 (Length: 422)
Name: NF14913_high_9
Description: NF14913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14913_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 45 - 382
Target Start/End: Original strand, 699532 - 699863
Alignment:
| Q |
45 |
atgaaactgaaggggtgttatatattttgtccatgaagttttgattatatattcccttagttcactttctcactttcactgtttagttacaaggtaagta |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
699532 |
atgaaactgaaggggtgttatatattttgtccatgaagttttgattatatattcccttagctcactttctcactttcactgtttagttacaaagtaagta |
699631 |
T |
 |
| Q |
145 |
gataaatgttatgaacactttctaacactcgtttttatattggatgaaaccgatgagtcttaccactttatatgtgattcatttctaaagtatggtgtct |
244 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||||||||||||| |||| || |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
699632 |
gataaatgttatgaacactttctaacacccatttttatattggatgaaatcgat------tatcactttatatgtgattcatttctaaagtgtggtgtct |
699725 |
T |
 |
| Q |
245 |
acatagattacatctaataaaaaatgaatgttatagagtgttaagaagagaatgtcatgtttagccatagactccctccctcgtattactattgacgaca |
344 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
699726 |
acatagattacatctaataaaaaatgaatgttatagagtgttaagaagagaatgtcatgtttagccatagactccctccctcgcattactattgacaaca |
699825 |
T |
 |
| Q |
345 |
tgcataatttatcttcttttttactcaattgattgtta |
382 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699826 |
tgcataatttatcttcttttttactcaattgattgtta |
699863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University