View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14913_low_25 (Length: 254)

Name: NF14913_low_25
Description: NF14913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14913_low_25
NF14913_low_25
[»] chr1 (3 HSPs)
chr1 (1-127)||(47518787-47518913)
chr1 (184-238)||(47518676-47518730)
chr1 (184-238)||(47514013-47514067)


Alignment Details
Target: chr1 (Bit Score: 119; Significance: 7e-61; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 47518913 - 47518787
Alignment:
Q  1 tgttagtgttgtcgggtgtctgggtctatgtcattgcttcaatgatggtttcaatggcatgagattgacatgctcgtgtgtgtaatgctcttgaatataa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||    
T  47518913 tgttagtgttgtcgggtgtctgggtctatgtcattgcttcaatgatggtttcagtggcatgagattgacatgctcgtgtgtgtaatgttcttgaatataa 47518814  T
Q  101 gatcaattagtcactgataaacaaact 127  Q
    |||||||||||||||||||||||||||    
T  47518813 gatcaattagtcactgataaacaaact 47518787  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 47518730 - 47518676
Alignment:
Q  184 aaattgtatttggttatgcttttgatttggcaatgaaatgaataattggagagtg 238  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47518730 aaattgtatttggttatgcttttgatttggcaatgaaatgaataattggagagtg 47518676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 47514067 - 47514013
Alignment:
Q  184 aaattgtatttggttatgcttttgatttggcaatgaaatgaataattggagagtg 238  Q
    |||||||| || |||||||||||||||||||||||||||||||||||||||||||    
T  47514067 aaattgtacttagttatgcttttgatttggcaatgaaatgaataattggagagtg 47514013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University