View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14914_high_8 (Length: 284)
Name: NF14914_high_8
Description: NF14914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14914_high_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 232; Significance: 1e-128; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 1 - 272
Target Start/End: Complemental strand, 43468329 - 43468057
Alignment:
| Q |
1 |
agaatgtctgtgttgatattgttcacataagttagacatgactattggattgagcaaaagtatgctcaataatcattgacacgcaaacctactcttctat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43468329 |
agaatgtctgtgttgatattgttcacataagttagacatgactattggattgagcaaaagtatgctcaataatcattgacacggaaacctactcttctat |
43468230 |
T |
 |
| Q |
101 |
ttcttttggctt-ttttggataatcttaggattttatatgaaatttggataaacattcatatatatttgtggatgaagtatgctcaatnnnnnnntaccc |
199 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
43468229 |
ttcttttggctttttttggataatcctaggattttatatgaaatttggataaacattcatgtatatttgtggatgaagtatgctcaataaaaaaataccc |
43468130 |
T |
 |
| Q |
200 |
tgaattcagtggtaatagtttgatattgtaaattttgaattttcttccttgaaattataaggctaaactcctt |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43468129 |
tgaattcagtggtaatagtttgatattgtaaattttgaattttcttccttgaaattataaggctaaactcctt |
43468057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 38 - 116
Target Start/End: Complemental strand, 43477278 - 43477195
Alignment:
| Q |
38 |
atgactattggattgagcaaaagtat----gctcaataatcatt--gacacgcaaacctactcttctatttcttttggctttttt |
116 |
Q |
| |
|
||||||||| |||||||||||||| | |||||||||||||| | |||||| |||||| ||| ||||||||||||||||||| |
|
|
| T |
43477278 |
atgactattagattgagcaaaagtttaccagctcaataatcattaagccacgcagacctac-cttgtatttcttttggctttttt |
43477195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University