View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14914_low_12 (Length: 255)
Name: NF14914_low_12
Description: NF14914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14914_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 2774042 - 2773801
Alignment:
| Q |
1 |
ttgaatactatgatgcaagaagtagctgcttcgttgctaatggagtttgagaagtgggtgcttcaagcagaatcttctggaactattctcaagacgcctt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2774042 |
ttgaatactatgatgcaagaagtagctgcttcgttgctaatggagtttgagaagtgggtacttcaagcagaatcttctggaactattctcaagacacctt |
2773943 |
T |
|
| Q |
101 |
tggattctcaagctagtctcagctcagaggaggtgttcatgttttaggtgtcatgaatcatgattattattgttgnnnnnnnnnnnnatatcttggcggt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2773942 |
tggattctcaagctagtctcagctcagaggaggtgttcatgttttaggtgtcatgaatcatgattattattgttg-tttttatttttatatcttggcggt |
2773844 |
T |
|
| Q |
201 |
gttatgtgttataatgtggattttgatttttggtttcgtgttc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2773843 |
gttatgtgttataatgtggattttgatttttggttttgtgttc |
2773801 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University