View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14915_high_16 (Length: 394)
Name: NF14915_high_16
Description: NF14915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14915_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 222
Target Start/End: Complemental strand, 11608560 - 11608353
Alignment:
| Q |
16 |
atgaacccatcattaggcaccatagtagccctccatttctgccattggacaaacatctttgctgctttatctgaatccattgaccgagcaatcaaaaacc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
11608560 |
atgaacccatcattaggcaccatagtagccctccatttctgccattggacaaacatctttgctgctttatctgaatccattgatcgagcaatcaaaaacc |
11608461 |
T |
 |
| Q |
116 |
tcatcagtgtagggtccccataaccctgcaagttaatataa-aaaataatatgctatcatgatttacgtcagtgatattataaaaaatcacatcagtcct |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11608460 |
tcatcagtgtagggtccccataaccctgcaagttaatataaaaaaataatatgctaccatgatttacgtcagtgatattataaaaaatcacatcagtcct |
11608361 |
T |
 |
| Q |
215 |
atttgact |
222 |
Q |
| |
|
|||||||| |
|
|
| T |
11608360 |
atttgact |
11608353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 294 - 376
Target Start/End: Complemental strand, 11608351 - 11608269
Alignment:
| Q |
294 |
aaatctatcatatttcactgtgactgatgagatgagattcctgaccgcggggaatccaaattcaaacaaagttgctacaattt |
376 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||| |
|
|
| T |
11608351 |
aaatctgtcatatttcactgtgactgatgagatgagattcctgaccgtggggaatccaaattcaaacaaagttactacaattt |
11608269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University