View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14915_high_30 (Length: 278)
Name: NF14915_high_30
Description: NF14915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14915_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 113 - 261
Target Start/End: Original strand, 50568841 - 50568993
Alignment:
| Q |
113 |
gaacctttcgcatattggaatcatactcacagaggtcttcaaacaggaata----aataaataaataggagagacgagtactgacaacaataaccaataa |
208 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50568841 |
gaacctttcgcatgttggaatcatactcgcagaggtcttcaaacaggaataaataaataaataaataggagagacgagtagtgacaacaataaccaataa |
50568940 |
T |
 |
| Q |
209 |
aataaatagacttcacccgaagaaacaaaaagacaactgaacacctgctccac |
261 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
50568941 |
aataaatagacttcacccaaagaaacaaaaagacaactgaacacctgctccac |
50568993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 19 - 78
Target Start/End: Original strand, 50568783 - 50568842
Alignment:
| Q |
19 |
agcgaccacatccacacttgtcacattggtctcctcggacagaatcatactcggacagga |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50568783 |
agcgaccacatccacacttgtcacattggtctcctcggacagaatcatactcggacagga |
50568842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University