View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14915_high_42 (Length: 235)
Name: NF14915_high_42
Description: NF14915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14915_high_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 76 - 214
Target Start/End: Original strand, 24883472 - 24883610
Alignment:
| Q |
76 |
aatctgtttcatttcttcattttccatttgtaaacttatcatactctctccatagtatgatatcttgtgcagatcaaaataataaatgggcttcttacgc |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24883472 |
aatctgtttcatttcttcattttccatttggaaacttatcatactctctccatagtatgatatcttgcgcagatcaaaataataaatgggcttcttacgc |
24883571 |
T |
|
| Q |
176 |
tggacctggaggatggaatggtaaacatcctaataatat |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24883572 |
tggacctggaggatggaatggtaaacatcctaataatat |
24883610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 157 - 199
Target Start/End: Complemental strand, 32590408 - 32590366
Alignment:
| Q |
157 |
ataaatgggcttcttacgctggacctggaggatggaatggtaa |
199 |
Q |
| |
|
|||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
32590408 |
ataaatgggcatcttatgctggacctggaggatggaatggtaa |
32590366 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 199
Target Start/End: Complemental strand, 32600854 - 32600814
Alignment:
| Q |
159 |
aaatgggcttcttacgctggacctggaggatggaatggtaa |
199 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
32600854 |
aaatgggcatcttatgctggacctggaggatggaatggtaa |
32600814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 159 - 199
Target Start/End: Complemental strand, 34578166 - 34578126
Alignment:
| Q |
159 |
aaatgggcttcttacgctggacctggaggatggaatggtaa |
199 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
34578166 |
aaatgggcatcttatgctggacctggaggatggaatggtaa |
34578126 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 156 - 199
Target Start/End: Complemental strand, 34593959 - 34593916
Alignment:
| Q |
156 |
aataaatgggcttcttacgctggacctggaggatggaatggtaa |
199 |
Q |
| |
|
||||||||||| || || |||||||||||||||||||||||||| |
|
|
| T |
34593959 |
aataaatgggcatcgtatgctggacctggaggatggaatggtaa |
34593916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University