View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14915_low_14 (Length: 399)
Name: NF14915_low_14
Description: NF14915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14915_low_14 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 1 - 399
Target Start/End: Complemental strand, 42664730 - 42664336
Alignment:
| Q |
1 |
tttgctcggatagattcttctctttcgatatcgatacacattcctgaatcaaaattgttatgttgatggacaaaagttgcatcaatattgcacttcaaag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42664730 |
tttgctcggatagattcttctctttcgatatggatacacattcctgtatcaaaattgttatgttgatggacaaaagttgcatcaatattgcacttcaaag |
42664631 |
T |
|
| Q |
101 |
tttcattctccgatatttccatccttgatcaactattcatgtgtcagtattttgcatagtagaaaaccatctaattaactcgagttcattttgcaacaat |
200 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||| ||||||||||||||| ||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42664630 |
tttcattctccgatttttccattcttgatcaactattcctgtgtcagtattttgtatagtcgaaaaccatctaa----ctcgagttcattttgcaacaat |
42664535 |
T |
|
| Q |
201 |
tctcatgaagtatatacatcccgatgatagtaccgatatttccacattgtcatgtgccttctcgttttgttgcttccagattatcaacagctgcgtcaca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42664534 |
tctcatgaagtatatacatcccgatgatagtaccgatatttccacattgtcatgtgccttctcgttttgttgcttccagattatcaacagctgcgtcaca |
42664435 |
T |
|
| Q |
301 |
gattaagaaagacgttgactatgcaaaattaacaataaattaaacaaaccttcttaaagcttcattcaatccgaattgcgttctcattctccgtccaca |
399 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42664434 |
gattaagaaagacgttgactatgcaaaattaacaataaattaaacaaaccttcttaaagcttcattcaatccgaattgcgttctcattctccgtccaca |
42664336 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University