View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14915_low_47 (Length: 224)
Name: NF14915_low_47
Description: NF14915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14915_low_47 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 167; Significance: 1e-89; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 29 - 207
Target Start/End: Complemental strand, 13137585 - 13137407
Alignment:
| Q |
29 |
taattaaccatgaattttgacaaaccacagttaattgtgtttagtggatgcttaaagaatttactaatgaattttaattttttattggtcttggtccatc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13137585 |
taattaaccatgaattttgacaaaccacagttaattgtgtttagtggatgcttagaggatttactaatgaattttaattttttattggtcctggtccatc |
13137486 |
T |
 |
| Q |
129 |
tcaaatatgttgatgctgaaaacatctattgtttattgtttatgaaaactgtttctcttttccctttttatcggttcat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13137485 |
tcaaatatgttgatgctgaaaacatctattgtttattgtttatgaaaactgtttctcttttccctttttatcggttcat |
13137407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 44 - 89
Target Start/End: Complemental strand, 13137664 - 13137619
Alignment:
| Q |
44 |
tttgacaaaccacagttaattgtgtttagtggatgcttaaagaatt |
89 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||| |||| ||||| |
|
|
| T |
13137664 |
tttgacaaatcactgttaattgtgtttagtggatgattaacgaatt |
13137619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University