View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14915_low_48 (Length: 215)
Name: NF14915_low_48
Description: NF14915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14915_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 19 - 193
Target Start/End: Complemental strand, 36565834 - 36565659
Alignment:
| Q |
19 |
tatcataggtaccattgtatgcaatggttacaaatgttagtttttgcggtgctttggttcactgcaaaatgnnnnnnn-aggattcatagcaaaattata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36565834 |
tatcataggtaccattgtatgcaatggttacaaatgttagtttttgcggtgctttggttcactgcaaaatgttttttttaggattcatagcaaaattata |
36565735 |
T |
|
| Q |
118 |
gaacgagattaccttaaatggatgggttttactcttaactttatttatgaatgtcagtttatatatacaaatattt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36565734 |
gaacgagattaccttaaatggatgggttttactcttaactttatttatgaatgtcagtttatatatacaaatattt |
36565659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University