View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14915_low_9 (Length: 492)
Name: NF14915_low_9
Description: NF14915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14915_low_9 |
 | |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 469; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 469; E-Value: 0
Query Start/End: Original strand, 16 - 492
Target Start/End: Original strand, 34190403 - 34190879
Alignment:
| Q |
16 |
tcttcatcatcacctgaaaccaccagctctgctgatggtttccatctcgactccaatgcactccagcgtctcacaggcaaacctatccctctgcgtttgt |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34190403 |
tcttcatcatcacctgaaaccactagctctgctgatggtttccatctcgactccaatgcactccagcgtctcacaggcaaacctatccctctgcgtttgt |
34190502 |
T |
|
| Q |
116 |
ctgtgtacgctggaagcatgggtcaaacttgcggtatagcaaattcgaagcttttaggtcgtgttgttgttaatattgatcttaaaaactctttgtctcg |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34190503 |
ctgtgtacgctggaagcatgggtcgaacttgcggtatagcaaattcgaagcttttaggtcgtgttgttgttaatattgatcttaaaaactctttgtctcg |
34190602 |
T |
|
| Q |
216 |
ttcagttatgtttcatagtggatggcttgcattgggaaaaaagaaaggatttgaaccgggaaagaaggattcggctcgggttcatttcgtggttcggact |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34190603 |
ttcagttatgtttcatagtggatggcttgcattgggaaaaaagaaaggatttgaaccgggaaagaaggattcggctcgggttcatttcgtggttcggact |
34190702 |
T |
|
| Q |
316 |
gaaccggatccacggttcttatttcaattcggaggcgaaccggaatgtagtcccgtggtttttcagattcaagagaatattagacaaccggtttttagtt |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34190703 |
gaaccggatccacggttcttatttcaattcggaggcgaaccggaatgtagtcccgtggtttttcagattcaagagaatattagacaaccggtttttagtt |
34190802 |
T |
|
| Q |
416 |
gcaaatttagtgctgatcgaaattctagatcaaggtgagtttggttaatcttgttttttgcattttaatactgtttt |
492 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34190803 |
gcaaatttagtgctgatcgaaattctagatcaaggtgagtttggttaatcttgttttttgcattttaatactgtttt |
34190879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.0000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 349 - 419
Target Start/End: Complemental strand, 43037352 - 43037282
Alignment:
| Q |
349 |
ggcgaaccggaatgtagtcccgtggtttttcagattcaagagaatattagacaaccggtttttagttgcaa |
419 |
Q |
| |
|
|||||||||||||||||||| || |||| |||||||| |||||||| | ||||||| ||||||| ||||| |
|
|
| T |
43037352 |
ggcgaaccggaatgtagtcctgttattttccagattcaggagaatatcaaacaaccgatttttagctgcaa |
43037282 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University