View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14916_high_17 (Length: 264)
Name: NF14916_high_17
Description: NF14916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14916_high_17 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 82 - 248
Target Start/End: Complemental strand, 5175087 - 5174923
Alignment:
| Q |
82 |
tataattgagtttcatttggacaaaccaaattggaa---atcttaatctgtctaaggtcattttttgcttagcttggactattgaaatttactaactgct |
178 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5175087 |
tataattgagtttcatttggacaaacccaattggaattaatcttaatctgtctaaggtcattttttgctt-----ggactattgaaatttactaactgct |
5174993 |
T |
 |
| Q |
179 |
agtgactacatctattatctttttgtttttaactcattattgccatttttattgtcaataataatgatta |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174992 |
agtgactacatctattatctttttgtttttaactcattattgccatttttattgtcaataataatgatta |
5174923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University