View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14916_low_14 (Length: 346)
Name: NF14916_low_14
Description: NF14916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14916_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 16 - 318
Target Start/End: Complemental strand, 54950559 - 54950266
Alignment:
| Q |
16 |
cagtgaccaatgaatccggcataaaacatacacaaataagaaacaagaatttgaatcgaaactacctaccaagcacatcgacattgtagaaatcatcatc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54950559 |
cagtgaccaatgaatccggcataaaacatacacaaataagaaacaagaatttgaatcgaaactacctaccaagcacatcgacattgtagaaatcatcatc |
54950460 |
T |
|
| Q |
116 |
aaaaccaaaccctagctaataagaaattcgatcggagtgagacaaacaaacatcgatgaaaaaataagaaggaagagagaaccttattgtagcagcagca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
54950459 |
aaaaccaaaccctagctaataagaaattcgatcggagtgagacaaacaaacatcgatgaaaaaataagaaggaagagagaaccttatt---------gca |
54950369 |
T |
|
| Q |
216 |
gaagcagctaccaacggagttcaattaaattgaaacaaaccaagatataagtaacgtgcgatttggttcggaccagaaggcagtagtacgcgatttatct |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54950368 |
gaagcagctaccaacggagttcaattaaattgaaacaaaccaagatataattaacgtgcgatttggttcggaccagaaggcagtagtacgcgatttatct |
54950269 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University