View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14916_low_26 (Length: 250)
Name: NF14916_low_26
Description: NF14916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14916_low_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 3 - 242
Target Start/End: Complemental strand, 32843555 - 32843316
Alignment:
| Q |
3 |
atgtttcgtcatttttcactttattttttggtggttttctaatttaaaagtcgcaatcgtcgaattgaaaagagattctaattgtttgcttatgcatagg |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32843555 |
atgtttcgtcatttttcactttattttttggtggttttctaatttaaaagtcacaatcgtcgaattgaaaagagattctaattgtttgcttatgcatagg |
32843456 |
T |
 |
| Q |
103 |
cgtgttttgaattttataatccaaactgtgttttcgattcggattatataatatgagcgggcgtaaaatgagaattttaagcggcgtgtgaaaaatgagt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32843455 |
cgtgttttgaattttataatccaaactgtattttcgattcggattatataatataagcgggcgtaaaatgagaattttaagcggcgtgtgaaaaatgagt |
32843356 |
T |
 |
| Q |
203 |
agagtagaaaaagaaatttcgaagaaaatatgttcttctc |
242 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
32843355 |
agagtagaaaaagaaatttccaagaaaatatgttcttctc |
32843316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University