View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14916_low_30 (Length: 237)
Name: NF14916_low_30
Description: NF14916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14916_low_30 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 141
Target Start/End: Original strand, 8884952 - 8885077
Alignment:
| Q |
16 |
aatatcgcatatcaaggctcaaatataaaattaatatttacatttagtaccgacacgtcttgaatagaattattattattttgttacattcaaatagaat |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8884952 |
aatatcgcatatcaaggctcaaatataaaattaatatttacatttagtaccggcacatcttgaatagaattattattattttgttacattcaaatagaat |
8885051 |
T |
 |
| Q |
116 |
tatctataatgcataaaatataatgg |
141 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8885052 |
tatctataatgcataaaatataatgg |
8885077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 173 - 220
Target Start/End: Original strand, 8885109 - 8885156
Alignment:
| Q |
173 |
gaccatcaaagaaggttacaaaggcaacatagaatatctagtcataat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8885109 |
gaccatcaaagaaggttacaaaggcaacatagaatatctagtcataat |
8885156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University