View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14917_high_14 (Length: 339)
Name: NF14917_high_14
Description: NF14917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14917_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 334794 - 335071
Alignment:
| Q |
1 |
tgcttcatgagataactgatttgcaatggaggtattgtattataaaagctagttggattatatgctaaaatataggtggttttactcattaaccttgctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
334794 |
tgcttcatgagataactgatttgcaatggaggtattgtattataaaagttagttggattatatgctaaaatataggtggttttactcattaaccttgctt |
334893 |
T |
 |
| Q |
101 |
tgtatcatc--taggctcatatgcacccaggaagagcttcaaaaattgaaaacagataatgctcaggtattatcaaacgctttggctagtaataacatat |
198 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
334894 |
tgtatcatctataggctcatatgcacccaggaagagcttcaaaaattgaaaacagataatgctcaggtattatcaaacgctttggctagtaataacatat |
334993 |
T |
 |
| Q |
199 |
tcttgtgaataatgatgggacttcacactc-taacttgttctgacctctaaaatcataggtgtgattggattgtcagaa |
276 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
334994 |
tcttgtgaataatgat-ggacttcacactcttaacttgttctgacctctaaaatcataggtgtgattggattgtcagaa |
335071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University