View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14917_high_16 (Length: 327)
Name: NF14917_high_16
Description: NF14917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14917_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 37131697 - 37131499
Alignment:
| Q |
1 |
attattctccttcaataaatacatcaattgagttacttgtatacaatgatctttatgtacttttctttcattctataattcctttcccggaaacccctat |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37131697 |
attattctccttcaataaataaatcaattgagttacttgtatacaatgatctttatgtacttttctttcattctataattcctttcccggaaacccctat |
37131598 |
T |
 |
| Q |
101 |
ttcactttgtctcatagcttctaaacaaagacttggtaaatatttttattagcttgtatgactaaatggtctagagagttggtgatgacttttaaaaca |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37131597 |
ttcactttgtcacatagcttctaaacaaagacttggtaaatatttttattagcttgtatgactaaatggtctagagagttggtgatgacttttaaaaca |
37131499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 221 - 309
Target Start/End: Complemental strand, 37131472 - 37131384
Alignment:
| Q |
221 |
ggaaaatatgtgtattttcatcaattagtcaattaatgttgcatgtctttgatggtaaaatgtgtgcagcaaaagatagtgatcaaggt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37131472 |
ggaaaatatgtgtattttcatcaattagtcaattaatgttgcatgtctttgatggtaaaatgtgtgcagcaaaagatagtgatcaaggt |
37131384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 266 - 309
Target Start/End: Complemental strand, 31297313 - 31297270
Alignment:
| Q |
266 |
tctttgatggtaaaatgtgtgcagcaaaagatagtgatcaaggt |
309 |
Q |
| |
|
|||||||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
31297313 |
tctttgattgtgaaatgtttgcagcaaaagatagtgatcaaggt |
31297270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 266 - 309
Target Start/End: Original strand, 1193722 - 1193765
Alignment:
| Q |
266 |
tctttgatggtaaaatgtgtgcagcaaaagatagtgatcaaggt |
309 |
Q |
| |
|
|||||||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
1193722 |
tctttgattgtgaaatgtttgcagcaaaagatagtgatcaaggt |
1193765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University