View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14917_high_34 (Length: 235)
Name: NF14917_high_34
Description: NF14917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14917_high_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 37468238 - 37468007
Alignment:
| Q |
1 |
cacaagtctctctattctccgtttagagatgtgacccaagctcttgtgctataatgaaacatgattttcattggctaattttctttttatacctcttgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37468238 |
cacaagtctctctattctccgtttagagatgtgacccaagctcttgtgctataatgaaacataattttcattggctaattttctttttatacctcttgta |
37468139 |
T |
|
| Q |
101 |
ctacttgattgcagtgtttcat-----------ttaatggaataaatattatcataatctggtcaagaattgaaactgcaccaattttgaatcttgatac |
189 |
Q |
| |
|
|||||||| |||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37468138 |
ctacttgacagcagtgtttcataagcaatgatatcaatggaataaatattatcataatctggtcaagaattgaaactgcaccaattttgaatcttgatac |
37468039 |
T |
|
| Q |
190 |
aaactaaattttccattctcaaatgaacaaga |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37468038 |
aaactaaattttccattctcaaatgaacaaga |
37468007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University