View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14917_high_37 (Length: 214)
Name: NF14917_high_37
Description: NF14917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14917_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 20 - 199
Target Start/End: Original strand, 25614264 - 25614443
Alignment:
| Q |
20 |
acctaaggaaagtgacaaagttgttttaacgtgtatacatgaattattggtttgaattaacgttgaaacttgaaatattactacaagtagcaggatcacg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614264 |
acctaaggaaagtgacaaagttgttttaacgtgtatacatgaattattggtttgaattaacgttgaaacttgaaatattactacaagtagcaggatcacg |
25614363 |
T |
 |
| Q |
120 |
taaccaataatttctatttttgtgcatagctttcatgcaacctatatgaccattttgagtagtgtggcagtgtcaatgat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25614364 |
taaccaataatttctatttttgtgcatagctttcatgcaacctatatgaccattttgagtagtgtggcagtgtcaatgat |
25614443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University