View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14917_low_35 (Length: 239)
Name: NF14917_low_35
Description: NF14917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14917_low_35 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 6 - 239
Target Start/End: Original strand, 8217778 - 8218010
Alignment:
| Q |
6 |
accatgttcatcatagtagctgaaatttgaactttgcattttgcagcaattatattggaggtaccatagttgcgctagtggaacagaacaatcaagccct |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
8217778 |
accatgttcatcatagtagctgaaatttgaactttgcattttgcagcaattatattggaggtaccacaggtgcgctagtggaacagaacaatcaagccct |
8217877 |
T |
 |
| Q |
106 |
aggtttaatcgaggaaaatcttgctgctttttagtgctctaaatttaatgcaggtaaatcatgctgttttttgtagctgaaataatttaattgatcaact |
205 |
Q |
| |
|
||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8217878 |
aggtttaatcgaggaaaatcttgctgc-ttttggtgctctaaatttaatgcaggtaaatcatgctgttttttgtagctgaaataatttaattgatcaact |
8217976 |
T |
 |
| Q |
206 |
tgcagtacatgaaaataatcctttactccttcga |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8217977 |
tgcagtacatgaaaataatcctttactccttcga |
8218010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University