View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14917_low_40 (Length: 230)
Name: NF14917_low_40
Description: NF14917
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14917_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 77; Significance: 7e-36; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 98
Target Start/End: Complemental strand, 7763726 - 7763625
Alignment:
| Q |
1 |
ctaatacaaatcaggcgcatcttcaaagactaagagaagcaacacaaaaaagttta----aaaactggataacaaaggttagaacttgaaacacaagtta |
96 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7763726 |
ctaatacaaatcagtcacatcttcaaagactaagagaagcaacacaaaaaagtttaaaaaaaaactggataacaaaggttagaacttgaaacacaagtta |
7763627 |
T |
|
| Q |
97 |
ca |
98 |
Q |
| |
|
|| |
|
|
| T |
7763626 |
ca |
7763625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 97 - 207
Target Start/End: Complemental strand, 7763588 - 7763488
Alignment:
| Q |
97 |
catagtgtggtagtggacccggatccgctatctttaaagcggaaaaatcactatcactttgtgtctatctctctcctatattgcactatctccctgtcgt |
196 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| |||||||| |||||| ||| |||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7763588 |
catagtgtcgtagtggacccagatccgctacctttaaag---aaaaattact-------tgtgtctatctctctcctatattgcactatctccctctcgt |
7763499 |
T |
|
| Q |
197 |
cttgtttatca |
207 |
Q |
| |
|
||| ||||||| |
|
|
| T |
7763498 |
cttatttatca |
7763488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 137 - 181
Target Start/End: Complemental strand, 1113716 - 1113672
Alignment:
| Q |
137 |
ggaaaaatcactatcactttgtgtctatctctctcctatattgca |
181 |
Q |
| |
|
|||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1113716 |
ggaaaagtcactataactttgtgtctatctctctcctatattgca |
1113672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University