View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14918_high_6 (Length: 341)
Name: NF14918_high_6
Description: NF14918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14918_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 323
Target Start/End: Original strand, 5333864 - 5334186
Alignment:
| Q |
1 |
tcaatcgccggccgtactgcaaaatcgaatttctccggcggtggtgaagtttttgaatgaaccaaagtttcatctaaatcaagaaaaatggttttccgat |
100 |
Q |
| |
|
|||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5333864 |
tcaatcaccggccggacaacaaaatcgaatttctccggcggtggtgaagtttttgaatgaaccaaagtttcatctaaatcaagaaaaatggttttccgat |
5333963 |
T |
 |
| Q |
101 |
ttgatattgaaggtggaagaagagaattttcgacgctatcttcgaaaagcagggttttgcaaacggtgtcttgttgttgaaagttgaaatgtgctgattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5333964 |
ttgatattgaaggtggaagaagagaattttcgacgctatcttcgaaaagcagggttttgcaaacggtgtcttgttgttgaaagttgaaatgtgctgattt |
5334063 |
T |
 |
| Q |
201 |
cttgaggattttgtagctgtttcgtttccgatttgaagaactgagacgagtgagtcccagtttggtgagaagctttgaaatgcggcggtggatggaagaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5334064 |
cttgaggattttgtagctgtttcgtttccgatttgaagaactgagacgagtgagtcccagtttggtgagaagctttgaaatgcggcggtggatggaagaa |
5334163 |
T |
 |
| Q |
301 |
agaacggcggaggaagctgcgac |
323 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
5334164 |
agaacggcggaggaagctgcgac |
5334186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University