View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_high_15 (Length: 372)
Name: NF14919_high_15
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 5e-81; HSPs: 9)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 5 - 272
Target Start/End: Complemental strand, 29806221 - 29805961
Alignment:
| Q |
5 |
tagcaacactctcttttgagaactctctttaacactctcttttgaggaggaatgctagaannnnnnnnnatgcatgtctctcaccatagccttcatataa |
104 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29806221 |
tagcaacactctcttttgagcattctctctaacactct--tttgaggaggaatgctagaaaatatttttatgcatgtctctcaccatagccttcatataa |
29806124 |
T |
 |
| Q |
105 |
ttttcttcattttcattcgctgatgattaaat-tatttannnnnnnnggtcaagctgatgattaaaattatcatcaactaaacaatgcaaaagtggaggg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
29806123 |
ttttcttcattttcattcgctgatgattaattatattt---ttttttggtcaagctgatgattaaaattatcatcaactaaacaatgcaaaagtggagtg |
29806027 |
T |
 |
| Q |
204 |
ataataattttgagttacaccgttttcttcaacacctcttgaatggtactattcaattatgtattatga |
272 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29806026 |
ataat---tttgagttacacggttttcttcaacacctcttgaatggtactattcaattatgtattatga |
29805961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 300 - 372
Target Start/End: Complemental strand, 29805935 - 29805863
Alignment:
| Q |
300 |
cacacatatcttagactattaatttgtttatgtggaggatagagactcgggttactctacgataaagaatgtt |
372 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29805935 |
cacacatatcttagactattcatttgtttatgtggaggatagagacttgggttactctacgataaagaatgtt |
29805863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 28898036 - 28898076
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
28898036 |
atgctagcaacactctcttttgagtactctctttagcactc |
28898076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 27968920 - 27968960
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
27968920 |
atgctagcaacactctcttttgagtactctctctagcactc |
27968960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 28091667 - 28091627
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
28091667 |
atgctagcaacactctcttttgagtactctctctagcactc |
28091627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 28101899 - 28101859
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
28101899 |
atgctagcaacactctcttttgagtactctctctagcactc |
28101859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 41
Target Start/End: Complemental strand, 31395619 - 31395583
Alignment:
| Q |
5 |
tagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
31395619 |
tagcaacactctcttttgagcactctctttagcactc |
31395583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 37228500 - 37228540
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
37228500 |
atgctagcaacactctcttttgagcactctctctagcactc |
37228540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 42182891 - 42182931
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
42182891 |
atgctagcaacactctcttttgagcactctctctagcactc |
42182931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 1205829 - 1205869
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
1205829 |
atgctagcaacactctcttttgagcactctctttagcactc |
1205869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 31691689 - 31691649
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
31691689 |
atgctagcaacactcacttttgaaaactctctttaacactc |
31691649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 13407323 - 13407363
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
13407323 |
atgctagcaacactctcttttgaacactctctctaacactc |
13407363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000002; HSPs: 7)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 27888462 - 27888422
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
27888462 |
atgctagcaacactctcttttgagcactctctctaacactc |
27888422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 22786153 - 22786199
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactctctttt |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| ||||| |
|
|
| T |
22786153 |
atgctagcaacactctcttttgagcactctctctagcactcactttt |
22786199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 13919782 - 13919822
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
13919782 |
atgctagcaacactctcttttgagcactctctctagcactc |
13919822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 13919961 - 13919921
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
13919961 |
atgctagcaacactctcttttgagcactctctctagcactc |
13919921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 17354705 - 17354665
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
17354705 |
atgctagcaacactcttttttgagcactctctctaacactc |
17354665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 25428482 - 25428518
Alignment:
| Q |
5 |
tagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
25428482 |
tagcaacactctcttttgagcactctctttagcactc |
25428518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 27888284 - 27888324
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
27888284 |
atgctagcaacactcacttttgagcactctctctaacactc |
27888324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 37315565 - 37315605
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
37315565 |
atgctagcaacactctcttttgagcactctctctaacactc |
37315605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 2187813 - 2187853
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
||||||||||||||| |||||||| ||||||| |||||||| |
|
|
| T |
2187813 |
atgctagcaacactcgcttttgagcactctctctaacactc |
2187853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000008; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 42224590 - 42224621
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctct |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42224590 |
atgctagcaacactctcttttgagaactctct |
42224621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 28611778 - 28611816
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacac |
39 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
28611778 |
atgctagcaacactctcttttgagcactctctctaacac |
28611816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 41
Target Start/End: Complemental strand, 29155564 - 29155528
Alignment:
| Q |
5 |
tagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||| |
|
|
| T |
29155564 |
tagcaacactctcttttgagaactctctctgacactc |
29155528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 42224769 - 42224729
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
42224769 |
atgctagcaacactctcttttgagcactctctctagcactc |
42224729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.00000003; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 5 - 47
Target Start/End: Complemental strand, 10061036 - 10060994
Alignment:
| Q |
5 |
tagcaacactctcttttgagaactctctttaacactctctttt |
47 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
10061036 |
tagcaacactctcttttgagcactctctctaacactcactttt |
10060994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 4595921 - 4595892
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactct |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4595921 |
atgctagcaacactctcttttgagaactct |
4595892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 19090214 - 19090254
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
19090214 |
atgctagcaacactctcttttgagcactctctctagcactc |
19090254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 29775141 - 29775187
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactctctttt |
47 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||| ||||||| |
|
|
| T |
29775141 |
atgctagcaacactctcttttgagcactctctctagcacactctttt |
29775187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 5 - 41
Target Start/End: Original strand, 24748913 - 24748949
Alignment:
| Q |
5 |
tagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
24748913 |
tagcaacactctcttttgagcactctctctaacactc |
24748949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 27243047 - 27243087
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
27243047 |
atgctagcaacactctcttttgaacactctctctaacactc |
27243087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 29389191 - 29389151
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
||||||||||||||| |||||||| |||| ||||||||||| |
|
|
| T |
29389191 |
atgctagcaacactcacttttgagcactcactttaacactc |
29389151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.00000003; HSPs: 7)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 1 - 47
Target Start/End: Original strand, 13388336 - 13388382
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactctctttt |
47 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
13388336 |
atgctagcaacactctcttttgaatactctctctaacactcactttt |
13388382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 11135741 - 11135781
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
11135741 |
atgctagcaacactctcttttgagcactctctctagcactc |
11135781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 11135920 - 11135880
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
11135920 |
atgctagcaacactctcttttgaggactctctctagcactc |
11135880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 11430621 - 11430581
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
11430621 |
atgctagcaacactctcttttgagcactctctctagcactc |
11430581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 30678911 - 30678951
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||| |||||||| |
|
|
| T |
30678911 |
atgctagcaacactcttttttgagcactctctctaacactc |
30678951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Original strand, 41095608 - 41095648
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
41095608 |
atgctagcaacactctcttttgagcactctctctagcactc |
41095648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 1 - 41
Target Start/End: Complemental strand, 41095787 - 41095747
Alignment:
| Q |
1 |
atgctagcaacactctcttttgagaactctctttaacactc |
41 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| || ||||| |
|
|
| T |
41095787 |
atgctagcaacactctcttttgagcactctctctagcactc |
41095747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University