View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_high_20 (Length: 337)
Name: NF14919_high_20
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 247
Target Start/End: Original strand, 33788312 - 33788549
Alignment:
| Q |
12 |
tgtttaagtcccttaaccatttgattaagaatttgatccttgatttgttcgcatgaaaatatataatttaaaagagatcaacctcttaaatagattctaa |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
33788312 |
tgtttaattcccttaaccatttgattaagaatttgatctttgattttttcgcatgaaaatatataatttaaaagagatcaacctcttaaatagattataa |
33788411 |
T |
 |
| Q |
112 |
ttattacctacataaatcttttatagtggtgtattgggataccttggtttacc--agttgcgccaacacacacaaaatgagttctcttgaccattagttt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||| | |||||||||||||||||||||| |
|
|
| T |
33788412 |
ttattacctacataaatcttttatagtggtgtattgggataccttggtttacccaagttgcgctaacacacacaagacgagttctcttgaccattagttt |
33788511 |
T |
 |
| Q |
210 |
catatcatgcatgctttatgggtgtgttttctttgttt |
247 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33788512 |
catatcatgcatgcttcatgggtgtgttttctttgttt |
33788549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University