View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_high_27 (Length: 281)
Name: NF14919_high_27
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_high_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 100 - 214
Target Start/End: Original strand, 11316339 - 11316455
Alignment:
| Q |
100 |
tctatatgttttttaaattcatgccaaatacgattaaaagaggatttggtgtgcca---nnnnnnnngttcttcatccttaaatctgcccttctttgtca |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| || | | |||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
11316339 |
tctatatgttttttaaattcatgccaaatacaattaaaagagaatctcgagtgccattttcttttttgttcttcatccttaaatctg-tcttctttgtca |
11316437 |
T |
 |
| Q |
197 |
tcctctcattcttcttca |
214 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
11316438 |
tcctcccattcttcttca |
11316455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University