View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_high_29 (Length: 274)
Name: NF14919_high_29
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 263
Target Start/End: Complemental strand, 4132929 - 4132685
Alignment:
| Q |
19 |
aggtcgctataaagttttggtgtgtataactatgctattttgcggtcttgtattctggcgcagcacgttgatgtctttctcagcagagtgcagaaacgat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4132929 |
aggtcgctataaagttttggtgtgtataactatgctattttgcggtcttgtattttggcgcagcatgttgatgtctttctcagcagagtgcagaaacgat |
4132830 |
T |
 |
| Q |
119 |
tgggaatatttgtgctctgactattggattatttctctttatggagggtgtgactttgagccaatagttctcaaacttcaatgaatgtgattcgtgagaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4132829 |
tgggaatatttgtgctctgactattggattatttctctttatggagggtgtgactttgagccaatagttctcaaacttcaatgaatgtgattcgtgagaa |
4132730 |
T |
 |
| Q |
219 |
ttggaagtagctagcttttcattttgtgattgtagttcgttctgt |
263 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4132729 |
ttggaagtagctagcttttcattttgcgattgtagttcgttctgt |
4132685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University