View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14919_high_37 (Length: 237)

Name: NF14919_high_37
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14919_high_37
NF14919_high_37
[»] chr5 (1 HSPs)
chr5 (1-194)||(2991258-2991448)


Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 1 - 194
Target Start/End: Original strand, 2991258 - 2991448
Alignment:
1 tcaactttaaagattttactagcatgtatgtatgcttgagagaagactgaggattaatcagcttcagagattggaacacacaattatatgaccatattaa 100  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2991258 tcaactttaaagattttactagcatgcatgtatgcttgagagaagactgaggattaatcagcttcagagattggaacacacaattatatgaccatattaa 2991357  T
101 atctttgcaatcaacaccatgtattcnnnnnnnnnnnnnnngggtgcaccgtacacaccatgtacttttttattattgaaaattttagattaat 194  Q
    ||||||||||||||||||||||||||               |||||||||||||||||||||||||||||||||||||||||||||||||||||    
2991358 atctttgcaatcaacaccatgtattc---ttttttttttttgggtgcaccgtacacaccatgtacttttttattattgaaaattttagattaat 2991448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University