View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14919_high_40 (Length: 229)

Name: NF14919_high_40
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14919_high_40
NF14919_high_40
[»] chr2 (2 HSPs)
chr2 (17-120)||(40464923-40465026)
chr2 (183-219)||(40465088-40465124)


Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 17 - 120
Target Start/End: Original strand, 40464923 - 40465026
Alignment:
17 aaaaaatcgacagttaatgatgtatgacatatttcgaataaaagtatctttagtggagcttatttatagtgaactaaaataaaaagttgtcgcaaaaagc 116  Q
    |||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||||||| ||||||||||||||||||||||||||||||    
40464923 aaaaaatcgacagttaattatgtatgacatatttcgaataaaattatctttagtggagtttatttatagggaactaaaataaaaagttgtcgcaaaaagc 40465022  T
117 ttcc 120  Q
    ||||    
40465023 ttcc 40465026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 219
Target Start/End: Original strand, 40465088 - 40465124
Alignment:
183 gacaattattgttgaacgaattaaatattagaattat 219  Q
    |||||||||||||||||||||||||||||||| ||||    
40465088 gacaattattgttgaacgaattaaatattagatttat 40465124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University