View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_high_45 (Length: 213)
Name: NF14919_high_45
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_high_45 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 13 - 202
Target Start/End: Complemental strand, 38748076 - 38747881
Alignment:
| Q |
13 |
aaatgaacatttttcatgcaacaagaaaaataacaagcttttgaataaccatgttgcttcaaaatcaaacaattgttgtttgttttgtcactgtggtggt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38748076 |
aaatgaacatttttcatgcaacaagaaaaataacaagcttttgaataaccatgttgcttcaaaatcaaacaattgttgtttgttttgtcactgtggtggt |
38747977 |
T |
|
| Q |
113 |
aatg------gtaatggtaatggtgctaataattctccaacttcaacactttttggtatgtctcatttttcttcacctccggcatcaccacctatg |
202 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38747976 |
aatggtaacggtaatggtaatggtgctaataattctccaacttcaacactttttggtatgtctcatttttcttcacctccggcatcaccacctatg |
38747881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University