View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_low_27 (Length: 288)
Name: NF14919_low_27
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 9710867 - 9711010
Alignment:
| Q |
1 |
cttagggatggggagaatgc----caagcatcatattattttcctttagtgtgtggagctctttttgacctaaaaggttgaaacataagtagaatactta |
96 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9710867 |
cttagggatggggagaatgcatgccaagcatcatattattttcctttagtgtgtggagctctttttgacctaaaaggttgaaacataagtagaatactta |
9710966 |
T |
 |
| Q |
97 |
agagataggagaatatcgtttatttagttggtttgtatttagta |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9710967 |
agagataggagaatatcgtttatttagttggtttgtatttagta |
9711010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University