View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_low_36 (Length: 246)
Name: NF14919_low_36
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_low_36 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 209
Target Start/End: Complemental strand, 33788132 - 33787925
Alignment:
| Q |
1 |
tcattatcataaatttaaacatataaactcgtaggaagtgaagcataagcaattggactttggttttttcattaattgcatgtggtcagatgttacatat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
33788132 |
tcattatcataaatttaaacatataaactcgtaagaagtgaagcataagcaattggactttggttttt-cattaattgcatgtggtcaaatgttacatat |
33788034 |
T |
|
| Q |
101 |
tttaggctatgtgtcacgcagaccacactctatctgagatttaaccgacacatgtattttccttgtaaaacggacgaaacatgtttttgtgctctttgct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
33788033 |
tttaggctatgtgtcacgcagaccacactctacctgagatttaaccgacacatgtattttccttgtaaaacggacgaaacatgtttctgtgctctttgct |
33787934 |
T |
|
| Q |
201 |
aatcacttg |
209 |
Q |
| |
|
||||||||| |
|
|
| T |
33787933 |
aatcacttg |
33787925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University