View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_low_39 (Length: 237)
Name: NF14919_low_39
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_low_39 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 81 - 218
Target Start/End: Original strand, 39325345 - 39325482
Alignment:
| Q |
81 |
tgagtgttatttgtcattctcatacagtacgcctgtttgccaggttaattggagtgccattttccaattaagtgactaggtttccaaagctcgttacaaa |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39325345 |
tgagtgttatttgtcattctcatacagtacgcctgtttgccaggttaattgaagtgccattttccaattaagtgactaggtttccaaagctcgttacaaa |
39325444 |
T |
 |
| Q |
181 |
ttcaacatttcaaatccccaagttttactgcaacctct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39325445 |
ttcaacatttcaaatccccaagttttactgcaacctct |
39325482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University