View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_low_41 (Length: 237)
Name: NF14919_low_41
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_low_41 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 2991042 - 2991250
Alignment:
| Q |
1 |
agaagagaaagtgattgtcaattcaagttcatgtggcacaaaagagtgctctgattcattggtttgaannnnnnnnnnnnnnn--aatattttacaagat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
2991042 |
agaagagaaagtgattgtcaattcaagttcatgtggcacaaaagagtgctctgattcattagtttgaattttttatttattttttaatattttacaagat |
2991141 |
T |
 |
| Q |
99 |
ttaaatggtgaacaaattcattctttctagatttttgtactaatttttatattgtaaactaattaagagaagttaatgaggataagatttgaggctatac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2991142 |
ttaaatggtgaacaaattcattctttctagatttttgtactaatttttatattgtaaactaattaagagaagttaatgaggataagatttgaggctatac |
2991241 |
T |
 |
| Q |
199 |
aaggatttt |
207 |
Q |
| |
|
||||||||| |
|
|
| T |
2991242 |
aaggatttt |
2991250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University