View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_low_44 (Length: 229)
Name: NF14919_low_44
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_low_44 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 17 - 120
Target Start/End: Original strand, 40464923 - 40465026
Alignment:
| Q |
17 |
aaaaaatcgacagttaatgatgtatgacatatttcgaataaaagtatctttagtggagcttatttatagtgaactaaaataaaaagttgtcgcaaaaagc |
116 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||| |||||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
40464923 |
aaaaaatcgacagttaattatgtatgacatatttcgaataaaattatctttagtggagtttatttatagggaactaaaataaaaagttgtcgcaaaaagc |
40465022 |
T |
|
| Q |
117 |
ttcc |
120 |
Q |
| |
|
|||| |
|
|
| T |
40465023 |
ttcc |
40465026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 183 - 219
Target Start/End: Original strand, 40465088 - 40465124
Alignment:
| Q |
183 |
gacaattattgttgaacgaattaaatattagaattat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40465088 |
gacaattattgttgaacgaattaaatattagatttat |
40465124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University