View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14919_low_50 (Length: 208)
Name: NF14919_low_50
Description: NF14919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14919_low_50 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 5364554 - 5364742
Alignment:
| Q |
1 |
cacatcaacaaacacaatttccgtattcctttcgtttgtggctgtcgtaacctcggtgaagctcttcgccgaattcgcgaaggtgctgcgatgattcgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5364554 |
cacatcaacaaacacaatttccgtattcctttcgtttgtggctgtcgtaacctcggtgaagctcttcgccgaattcgcgaaggtgctgcgatgattcgta |
5364653 |
T |
|
| Q |
101 |
ccaaaggtgaagctggaactggtaatatcattgaagcagttcgtcatgtgcgttctgttttgggtgatatcagggttttgaggaatatg |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5364654 |
ccaaaggtgaagctggaactggtaatatcattgaagcagttcgtcatgtgcgttctgttttgggtgatatcagggttttgaggaatatg |
5364742 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University