View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1491_low_10 (Length: 222)
Name: NF1491_low_10
Description: NF1491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1491_low_10 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 2 - 222
Target Start/End: Original strand, 44185926 - 44186146
Alignment:
| Q |
2 |
ctttcagcagcccaaaactgaacaatgttcacaaaatgaatgttcacaatttacctaaggtctaaatccctatgccacaatattaaaacagtattaggga |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44185926 |
ctttcagcagcccaaaactgaacaatgttcacaaaatgaatgttcacaagttacctaaggtctaaatccctatgccacaatattaaaacagtattaggga |
44186025 |
T |
 |
| Q |
102 |
aaataactcattaatctatgtgcatatagattggacatatatttgcatattggaaaacaaaatggttttacaatcttgtgatgtggactgaatatctcat |
201 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44186026 |
aaatgactcattaatctatgtgcatatagattggacatatatttgcatattggaaaacaaaatggttttacaatcttgtgatgtggactgaatatctcat |
44186125 |
T |
 |
| Q |
202 |
cacatctaaacaagttgcagc |
222 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
44186126 |
cacatctaaacaagttgcagc |
44186146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 38 - 88
Target Start/End: Original strand, 44191953 - 44192003
Alignment:
| Q |
38 |
tgaatgttcacaatttacctaaggtctaaatccctatgccacaatattaaa |
88 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44191953 |
tgaatgttcacaagttacctaaagtctaaatccctatgccacaatattaaa |
44192003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 182 - 221
Target Start/End: Complemental strand, 30742357 - 30742318
Alignment:
| Q |
182 |
atgtggactgaatatctcatcacatctaaacaagttgcag |
221 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||| |
|
|
| T |
30742357 |
atgtggactgaatatctcatcacttttaaacaagttgcag |
30742318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University