View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1491_low_11 (Length: 207)
Name: NF1491_low_11
Description: NF1491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1491_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 83 - 177
Target Start/End: Original strand, 42534998 - 42535092
Alignment:
| Q |
83 |
gctgctaaaaacattgtatttgtacttgccgattctggtctttgtgcggcttttagtagtgaaacatatgagaggaactgctttatgaatctgca |
177 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
42534998 |
gctgctaaaaacattgtatttgttcttgccgaatctggtctttgtgcagcttttagtagtgaaacagatgagaggatttgctttatgaatctgca |
42535092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 42534733 - 42534777
Alignment:
| Q |
19 |
aacaatggatgaaaatactcgtggagggaaagaaggttctaacaa |
63 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42534733 |
aacaatggatgaaaatactcgtggagggaaagaaggttctaacaa |
42534777 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 141
Target Start/End: Original strand, 27820368 - 27820440
Alignment:
| Q |
69 |
ttgttcagattgtagctgctaaaaacattgtatttgtacttgccgattctggtctttgtgcggcttttagtag |
141 |
Q |
| |
|
||||| |||| || |||||||| || ||||| |||| ||||| |||||||||||||||| ||||||||||| |
|
|
| T |
27820368 |
ttgttgagatcgttgctgctaagaatattgtctttgctcttgctcattctggtctttgtgctgcttttagtag |
27820440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University