View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1491_low_11 (Length: 207)

Name: NF1491_low_11
Description: NF1491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1491_low_11
NF1491_low_11
[»] chr4 (2 HSPs)
chr4 (83-177)||(42534998-42535092)
chr4 (19-63)||(42534733-42534777)
[»] chr7 (1 HSPs)
chr7 (69-141)||(27820368-27820440)


Alignment Details
Target: chr4 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 83 - 177
Target Start/End: Original strand, 42534998 - 42535092
Alignment:
83 gctgctaaaaacattgtatttgtacttgccgattctggtctttgtgcggcttttagtagtgaaacatatgagaggaactgctttatgaatctgca 177  Q
    ||||||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||| |||||||||  |||||||||||||||||    
42534998 gctgctaaaaacattgtatttgttcttgccgaatctggtctttgtgcagcttttagtagtgaaacagatgagaggatttgctttatgaatctgca 42535092  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 19 - 63
Target Start/End: Original strand, 42534733 - 42534777
Alignment:
19 aacaatggatgaaaatactcgtggagggaaagaaggttctaacaa 63  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
42534733 aacaatggatgaaaatactcgtggagggaaagaaggttctaacaa 42534777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 69 - 141
Target Start/End: Original strand, 27820368 - 27820440
Alignment:
69 ttgttcagattgtagctgctaaaaacattgtatttgtacttgccgattctggtctttgtgcggcttttagtag 141  Q
    ||||| |||| || |||||||| || ||||| ||||  |||||  |||||||||||||||| |||||||||||    
27820368 ttgttgagatcgttgctgctaagaatattgtctttgctcttgctcattctggtctttgtgctgcttttagtag 27820440  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University