View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1491_low_6 (Length: 243)
Name: NF1491_low_6
Description: NF1491
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1491_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 19 - 225
Target Start/End: Complemental strand, 36377027 - 36376818
Alignment:
| Q |
19 |
cagatagagcagcgacaaggagagacgctgaaggggtgacgggtgcagaaatgagaaatgatccatatctcactactcatcctggaggagtgtctgcatc |
118 |
Q |
| |
|
||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36377027 |
cagatagagcagcgacaaggagagatgccgaaggggtgacgggtgcagaaatgagaaatgatccatatctcactactcatcctggaggagtgtcagcatc |
36376928 |
T |
 |
| Q |
119 |
aatggcagccgcagctaggcttaatcaaaagaataacaactagttgctaccttagtagttagctaccttatatatgtatattaatgg---ttatgctttt |
215 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36376927 |
aatggcagccgcagctaggcttaaccaaaagaataacaactagttgctacctaagtagttagctaccttatatatgtatattaatggttattatgctttt |
36376828 |
T |
 |
| Q |
216 |
ctgcttatgc |
225 |
Q |
| |
|
|||||||||| |
|
|
| T |
36376827 |
ctgcttatgc |
36376818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University