View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14920_high_11 (Length: 289)
Name: NF14920_high_11
Description: NF14920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14920_high_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 151
Target Start/End: Complemental strand, 33534577 - 33534424
Alignment:
| Q |
1 |
aataactttaatctagctagcataatta---aaaggagaacgcatatgattcattcatttattcaaaataaggtcactataaaaaacataaagagatgtt |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33534577 |
aataactttaatctagctagcataattattaaaaggagaacgcatatgattcattcatttattcaaaataaggttactataaaaaacataaagagatgtt |
33534478 |
T |
|
| Q |
98 |
taagattcgaaacttgagttccatgaggagaaaaatgaggctttttggacatga |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33534477 |
taagattcgaaacttgagttccatgaggagaaaaatgaggctttttggacatga |
33534424 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 233 - 273
Target Start/End: Complemental strand, 33534346 - 33534306
Alignment:
| Q |
233 |
ggtaaaaaatgtggctctttatagggctgaaataccacaaa |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33534346 |
ggtaaaaaatgtggctctttatagggctgaaataccacaaa |
33534306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University